SGN Marker C2_At2g47590

SGN-M7562
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303460 (SGN)
120271 (CGN)
---
Capsicum annuumSingleSGN-U197147---
Lycopersicon CombinedSingleSGN-U214962---
Solanum tuberosumMultipleSGN-U244322---
ArabidopsisSingleAt2g47590 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109232)
Chromosome
9
Position
55.82 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38406)
Chromosome
9
Position
61.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39652
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
CCAGGTTCCACATCACCTCTAGCAGGCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25986)
Chromosome
2
Position
19.53 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10913
Forward primer (5'-3')
AGCTGCTAATGCTTCCCTTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCATAACAGCTCGTACATCAGCCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400+650
Approximate temperature
55°C
  
PCR data   Exp. ID 10914
Forward primer (5'-3')
AGCTGCTAATGCTTCCCTTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCATAACAGCTCGTACATCAGCCAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400+650+1400
Approximate temperature
55°C
  
PCR data   Exp. ID 10915
Forward primer (5'-3')
AGCTGCTAATGCTTCCCTTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCATAACAGCTCGTACATCAGCCAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12264
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12265
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12266
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12267
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12268
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12269
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12270
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12271
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12272
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12273
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12274
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12275
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33340
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33341
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33342
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33343
Forward primer (5'-3')
ACGAGCGTCGATTGTTTGGTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTAGGATTGAGCCCCAAATCAACC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 580
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At2g47590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7562 marker 7562
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)