SGN Marker C2_At2g47890

SGN-M7567
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301914 (SGN)
125287 (CGN)
---
Lycopersicon CombinedMultipleSGN-U223139---
Solanum tuberosumSingleSGN-U248369---
ArabidopsisSingleAt2g47890 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38407)
Chromosome
9
Position
56.10 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39653
Forward primer (5'-3')
ACAACACAGCACTTTTGTATTGCAGAGC
Accessions and product sizes
Solanum pennellii TA56
2275
Solanum lycopersicum TA209
2300
Approximate temperature
58°C
Reverse primer (5'-3')
TTGTGTTTTCCACAAGCAGCATTTCG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1300
Solanum lycopersicum TA209
1400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25991)
Chromosome
2
Position
19.62 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g47890  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7567 marker 7567
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)