SGN Marker C2_At3g01160

SGN-M7575
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311437 (SGN)
127690 (CGN)
---
Capsicum annuumSingleSGN-U197612---
Lycopersicon CombinedSingleSGN-U217056---
Solanum tuberosumMultipleSGN-U265097---
ArabidopsisSingleAt3g01160 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38410)
Chromosome
2
Position
83.40 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39656
Forward primer (5'-3')
TCTGAAGAAGCTGAAGCAAGTAGAGC
Accessions and product sizes
Solanum lycopersicum TA209
1500
Solanum pennellii TA56
1500
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCAACTGACGAGCATAAGCTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25999)
Chromosome
3
Position
0.06 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32315
Forward primer (5'-3')
TCTGAAGAAGCTGAAGCAAGTAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCAACTGACGAGCATAAGCTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 420
Approximate temperature
55°C
  
PCR data   Exp. ID 32316
Forward primer (5'-3')
TCTGAAGAAGCTGAAGCAAGTAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCAACTGACGAGCATAAGCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 420
Approximate temperature
55°C
  
PCR data   Exp. ID 32317
Forward primer (5'-3')
TCTGAAGAAGCTGAAGCAAGTAGAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCAACTGACGAGCATAAGCTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 420
Approximate temperature
55°C
  
PCR data   Exp. ID 32318
Forward primer (5'-3')
TCTGAAGAAGCTGAAGCAAGTAGAGC
Digested band sizes (using EcoRI)
Solanum pennellii LA716: 100+290
Solanum lycopersicum LA925: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCAACTGACGAGCATAAGCTGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApoI,EcoRI
  
Accessions and product sizes
Solanum lycopersicum LA925: 420
Solanum pennellii LA716: 420
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text
Forward amplicon sequence for S. quitoense SE plant #1 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1 (2), plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text
Forward amplicon sequence for S. quitoense SE plant #1 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1 (2), plain text

Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At3g01160  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7575 marker 7575
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)