SGN Marker C2_At3g01480

SGN-M7579
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306559 (SGN)
129106 (CGN)
---
Lycopersicon CombinedSingleSGN-U217143---
Solanum tuberosumSingleSGN-U251515---
ArabidopsisSingleAt3g01480 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46650)
Chromosome
2
Position
7.30 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42208)
Chromosome
2
Position
102.40 cM
Confidence
I
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43774
Forward primer (5'-3')
TGTTGAAGACAGGACTCGAGATGCTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTGATATTCCTCAGGTACTTCATATGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41399)
Chromosome
2
Position
132.50 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43375
Forward primer (5'-3')
AAGTGTGTATTCTTCTGCCCCAAGTA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTGATATTCCTCAGGTACTTCATATGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38414)
Chromosome
2
Position
90.80 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39659
Forward primer (5'-3')
TGTTGAAGACAGGACTCGAGATGCTG
Accessions and product sizes
Solanum lycopersicum TA209
780
Solanum pennellii TA56
780
Approximate temperature
55°C
Reverse primer (5'-3')
TTGATATTCCTCAGGTACTTCATATGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
780
Solanum lycopersicum TA209
650
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26003)
Chromosome
3
Position
0.19 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10916
Forward primer (5'-3')
TGTTGAAGACAGGACTCGAGATGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGATATTCCTCAGGTACTTCATATGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10917
Forward primer (5'-3')
TGTTGAAGACAGGACTCGAGATGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGATATTCCTCAGGTACTTCATATGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10918
Forward primer (5'-3')
TGTTGAAGACAGGACTCGAGATGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGATATTCCTCAGGTACTTCATATGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g01480F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At3g01480  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7579 marker 7579
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)