SGN Marker C2_At3g02870

SGN-M7599
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300382 (SGN)
120416 (CGN)
---
Lycopersicon CombinedSingleSGN-U220202---
Solanum tuberosumMultipleSGN-U246882---
ArabidopsisSingleAt3g02870 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38418)
Chromosome
11
Position
38.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39663
Forward primer (5'-3')
TGAAGCTGCTAAAAAAGCTGGAGAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACAAAAGGGAACCCGTGCACAAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26023)
Chromosome
3
Position
0.63 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10940
Forward primer (5'-3')
TGAAGCTGCTAAAAAAGCTGGAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAAAGGGAACCCGTGCACAAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 280+1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10941
Forward primer (5'-3')
TGAAGCTGCTAAAAAAGCTGGAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAAAGGGAACCCGTGCACAAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 280+1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10942
Forward primer (5'-3')
TGAAGCTGCTAAAAAAGCTGGAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAAAGGGAACCCGTGCACAAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 280+1650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g02870  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7599 marker 7599
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)