Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker C2_At3g02910

SGN-M7600
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304451 (SGN)
121876 (CGN)
---
Lycopersicon CombinedSingleSGN-U222597---
Solanum tuberosumSingleSGN-U265305---
ArabidopsisSingleAt3g02910 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46652)
Chromosome
3
Position
51.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38419)
Chromosome
3
Position
72.40 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39664
Forward primer (5'-3')
ACCCACCATTATTTTCACCTACGG
Accessions and product sizes
Solanum lycopersicum TA209
900
Solanum pennellii TA56
900
Approximate temperature
55°C
Reverse primer (5'-3')
TCACATACCCTTTTGCCTCTTTCTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
700
Solanum pennellii TA56
250+500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26024)
Chromosome
3
Position
0.65 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32323
Forward primer (5'-3')
ACCCACCATTATTTTCACCTACGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACATACCCTTTTGCCTCTTTCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32324
Forward primer (5'-3')
ACCCACCATTATTTTCACCTACGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACATACCCTTTTGCCTCTTTCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32325
Forward primer (5'-3')
ACCCACCATTATTTTCACCTACGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACATACCCTTTTGCCTCTTTCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32326
Forward primer (5'-3')
ACCCACCATTATTTTCACCTACGG
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 150
Solanum pennellii LA716: 325
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACATACCCTTTTGCCTCTTTCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g02910  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7600 marker 7600
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)