SGN Marker C2_At3g03600

SGN-M7605
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302075 (SGN)
122876 (CGN)
---
Lycopersicon CombinedSingleSGN-U222185---
Solanum tuberosumSingleSGN-U246854---
ArabidopsisSingleAt3g03600 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38421)
Chromosome
1
Position
47.60 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39666
Forward primer (5'-3')
TCCATTCAGTAGTAATCCAAAAGCTCC
Accessions and product sizes
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
1100
Approximate temperature
55°C
Reverse primer (5'-3')
TCAAATTACAAAACAAATACACAAATTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26029)
Chromosome
3
Position
0.87 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32330
Forward primer (5'-3')
TCCATTCAGTAGTAATCCAAAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATTACAAAACAAATACACAAATTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 520
Approximate temperature
55°C
  
PCR data   Exp. ID 32331
Forward primer (5'-3')
TCCATTCAGTAGTAATCCAAAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATTACAAAACAAATACACAAATTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 520
Approximate temperature
55°C
  
PCR data   Exp. ID 32332
Forward primer (5'-3')
TCCATTCAGTAGTAATCCAAAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATTACAAAACAAATACACAAATTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 520
Approximate temperature
55°C
  
PCR data   Exp. ID 32333
Forward primer (5'-3')
TCCATTCAGTAGTAATCCAAAAGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATTACAAAACAAATACACAAATTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: BslI
  
Accessions and product sizes
Solanum lycopersicum LA925: 520
Solanum pennellii LA716: 520
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g03600  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7605 marker 7605
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)