SGN Marker C2_At3g06050

SGN-M7634
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310874 (SGN)
129065 (CGN)
---
Lycopersicon CombinedSingleSGN-U217220---
Solanum tuberosumMultipleSGN-U247041---
ArabidopsisSingleAt3g06050 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38430)
Chromosome
1
Position
46.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39675
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
Accessions and product sizes
Solanum lycopersicum TA209
1300
Solanum pennellii TA56
1350
Approximate temperature
55°C
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1350
Solanum lycopersicum TA209
1300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26059)
Chromosome
3
Position
1.83 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10969
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10970
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 10971
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13147
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13148
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13149
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 400+700
Approximate temperature
55°C
  
PCR data   Exp. ID 13150
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13151
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13152
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13153
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32628
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32995
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32996
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32997
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 400+700
Approximate temperature
55°C
  
PCR data   Exp. ID 10972
Forward primer (5'-3')
ATACACTATGAACGGTTGGGCAG
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAACTCTTGTGGAAGCTTCCATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g06050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7634 marker 7634
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)