SGN Marker SSR92

SGN-M765

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 40 High: 40.909
Repeat motif: CT   Repeat number: 11
Repeat motif:    Repeat number:
Forward primer: AAGAAGAAGGATCGATCGAAGA
Reverse primer: TCATGACCACGATACTACATGTTTC
Predicted size: 172
Derivations 
This marker was derived from EST read SGN-E111025
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 52844)
Chromosome
1
Position
55.61 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49378)
Chromosome
1
Position
1.22 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47313)
Chromosome
1
Position
4.38 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39303)
Chromosome
1
Position
0.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14074
Forward primer (5'-3')
AAGAAGAAGGATCGATCGAAGA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCATGACCACGATACTACATGTTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 171+172
Solanum pimpinellifolium LA1589: 172+173
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR92 was used as an overgo probe on plate 1 [well C11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAAGAAGGATCGATCGAAGATCAC
B sequence
GAGAGAGAGAGAGAGAGTGATCTT
AB sequence
GAAGAAGGATCGATCGAAGATCACTCTCTC
Marker sequence
GAAGAAGAAGGATCGATCGAAGATCACTCTCTCTCTCTCTCTCTCTCTTC
TGTGAGTTACATCTTGGTTTCATTATCTTGATGTCTATGAACTCGACTAG
TAGTTTACCAGATAAATTGATTTGTCGGGCATTCCTGGCCCACCTAACGA
AACATGTAGTATCGTGGTCATGACCAGCTAAGGCTAAAGTTTCATTAAAA
GGGCGTTTTCGATACCTTGGTTAGAGTCATTGTACTCTTTTTGACCCTAT
TTTAACATCTTTGGCTAAATGTTTCATTGATGTAAAGAAGTAGCAGCTTC
TAAACTATAGATATCTTTTCTTGCTTATTAATTTATCGAGTTTAAGTTAT
AT
Genomic location of SSR92  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D765 marker 765
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)