SGN Marker C2_At3g09740

SGN-M7676
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302841 (SGN)
125153 (CGN)
---
Capsicum annuumSingleSGN-U201454---
Lycopersicon CombinedSingleSGN-U217932---
Solanum tuberosumSingleSGN-U252967---
ArabidopsisSingleAt3g09740 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49240)
Chromosome
10
Position
63.17 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47175)
Chromosome
10
Position
69.19 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38444)
Chromosome
10
Position
71.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39685
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
Accessions and product sizes
Solanum lycopersicum TA209
1250
Solanum pennellii TA56
1300
Approximate temperature
55°C
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1300
Solanum lycopersicum TA209
1250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26102)
Chromosome
3
Position
2.99 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10993
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10994
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10995
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13171
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 13172
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 13173
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 13174
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 13175
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 13176
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 13177
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 13178
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32630
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 33004
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 33005
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 33006
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 33007
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 10996
Forward primer (5'-3')
TCCGACATAGAAACTGCTCTTCAG
Digested band sizes (using DraI)
Solanum pennellii LA716: 200
Solanum lycopersicum LA925: 100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTCCTCCGAATCTCAGCATTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: Dra
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At3g09740  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7676 marker 7676
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)