SGN Marker C2_At3g10060

SGN-M7683
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308453 (SGN)
128428 (CGN)
---
Capsicum annuumSingleSGN-U200029---
Lycopersicon CombinedSingleSGN-U230656---
Solanum tuberosumSingleSGN-U254487---
ArabidopsisSingleAt3g10060 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26109)
Chromosome
3
Position
3.10 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41358
Forward primer (5'-3')
TCAAGGGATGCGAGTAGGAGG
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
55°C
Reverse primer (5'-3')
TTACCATAAGCTAGCTCAGGAGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
750
Solanum lycopersicum TA209
650
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11001
Forward primer (5'-3')
TCAAGGGATGCGAGTAGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTACCATAAGCTAGCTCAGGAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 11002
Forward primer (5'-3')
TCAAGGGATGCGAGTAGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTACCATAAGCTAGCTCAGGAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 11003
Forward primer (5'-3')
TCAAGGGATGCGAGTAGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTACCATAAGCTAGCTCAGGAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 13179
Forward primer (5'-3')
TCAAGGGATGCGAGTAGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTACCATAAGCTAGCTCAGGAGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13180
Forward primer (5'-3')
TCAAGGGATGCGAGTAGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTACCATAAGCTAGCTCAGGAGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13181
Forward primer (5'-3')
TCAAGGGATGCGAGTAGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTACCATAAGCTAGCTCAGGAGG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 32631
Forward primer (5'-3')
TCAAGGGATGCGAGTAGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTACCATAAGCTAGCTCAGGAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33008
Forward primer (5'-3')
TCAAGGGATGCGAGTAGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTACCATAAGCTAGCTCAGGAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33009
Forward primer (5'-3')
TCAAGGGATGCGAGTAGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTACCATAAGCTAGCTCAGGAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g10060  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7683 marker 7683
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)