SGN Marker SSR96

SGN-M769

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 42.857
Repeat motif: AT   Repeat number: 12
Repeat motif:    Repeat number:
Forward primer: GGGTTATCAATGATGCAATGG
Reverse primer: CCTTTATGTCAGCCGGTGTT
Predicted size: 222
Derivations 
This marker was derived from EST read SGN-E88070
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43825)
Chromosome
2
Position
8.30 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44847
Forward primer (5'-3')
GGGTTATCAATGATGCAATGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCTTTATGTCAGCCGGTGTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43285)
Chromosome
2
Position
43.20 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44661
Forward primer (5'-3')
GGGTTATCAATGATGCAATGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCTTTATGTCAGCCGGTGTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40773)
Chromosome
2
Position
39.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39305)
Chromosome
2
Position
36.50 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 25
Forward primer (5'-3')
GGGTTATCAATGATGCAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CCTTTATGTCAGCCGGTGTT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 214+222
Solanum lycopersicum LA925: 222+224
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR96 was used as an overgo probe on plate 10 [well F7]

Plausible BAC Matches:   P011G04,   P298G23,   P024A11,   P155H19,   P116H12,   P173A13

 Non-Plausible BAC matches

P027P16,   P311M21,   P079N06

 Overgo Sequences

A sequence
AGCAGCACTTACCCATGTCTCTAC
B sequence
GTGGCATATGAGTAACGTAGAGAC
AB sequence
AGCAGCACTTACCCATGTCTCTACGTTACT
Marker sequence
TTCCCGGCCGGGCTTTGAATGGCAAAATTAAGGCTTCGATTAAAAGTCAT
ATAGCTAATCCATCAGTACAAGTATTCTCATCTGTAATAGCAGCACTTAC
CCATGTCTCTACGTTACTCATATGCCACTGGAAATCGGCTTTCCCATGGC
TATGATCCAAACTTTTCAGCTCATTCACAGATCTGCTAAGCCGATCTATA
CTATCACTCTTTTCAAGTTCGGATTTTTCTTTCAATTTTAAGCTTTTTGG
TGTCAAGTTTAGTATAATGAGTAGTAGAGTTTGAGTGTTTTTTTCCTATT
GATGTTAATATTAGCTTTGATGAAATTATAAACTCAAATAGGGTTATCAA
TGATGCAATGGACTTTTTTTGGTTAGGGTTTATAGAACAGAGTGAAAATC
ATTTTTTTAAAAAGTAATTATCTATTTGATATATATATATATATATATAT
ATAACATCGTCACCATTACATTAATGAGATGGATATAATTTGACTTTTTT
TTACGTGAATATGATGTGTCATTCATGTCAAATCAAGTGAGAAACACCGG
CTGACATAAAGGTTTAGAATTTCTATTTTGTTTGAGTCGAAGTATCTAGT
CCAAACTATGAATA
Genomic location of SSR96  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D769 marker 769
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)