SGN Marker TG651

SGN-M77

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
PCRII
Cutting Site
EcoR1
Drug Resistance
Amp*
Image
Forward sequence
GAAGTTGCCGATTTGAAACCGGATCGATACCGAGTCAAGGAACTCAGTTGAAGCCTCGATTGAGCTGGATGAAGGAAGCGAGTGAGCTCG
AAAGGTGCAAAAATGGCGGAAAATGGAGTGGATGAAAGTAAAGCAGACATTTGAATAACAGTTAATTTTTCTGAGTCCGTTCAGTTCTCA
GTAGTAGTTGAGTTCGCTCCCTTTTTCAGATTGGGATTTTTTTCGTGTTATTTTTGGGTATTATAAAGTATCAACCCAATACTATGAAAA
TAGTTGCGTTTTGGTCCCTCAAAAAAGGATTATTTATGTTTGGGGTAAGTCTAAAATGATTTCCAAAATATAAATTTTATATTTTAATAA
AAATAAAATACAAATTTTGTTTTGAACTTAATATAGATATATCTCATCGTATATTATCTAATTGGTAATATTACTTTATCCTAC
Reverse sequence
not available
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53373)
Chromosome
11
Position
19.04 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50419)
Chromosome
11
Position
2.27 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48351)
Chromosome
11
Position
30.73 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40123)
Chromosome
11
Position
18.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7981)
Chromosome
11
Position
17.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG651 was used as an overgo probe on plate 3 [well F7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCGATTTGAAACCGGATCGATACC
B sequence
CTGAGTTCCTTGACTCGGTATCGA
AB sequence
CCGATTTGAAACCGGATCGATACCGAGTCA
Marker sequence
GAAGTTGCCGATTTGAAACCGGATCGATACCGAGTCAAGGAACTCAGTTG
AAGCCTCGATTGAGCTGGATGAAGGAAGCGAGTGAGCTCGAAAGGTGCAA
AAATGGCGGAAAATGGAGTGGATGAAAGTAAAGCAGACATTTGAATAACA
GTTAATTTTTCTGAGTCCGTTCAGTTCTCAGTAGTAGTTGAGTTCGCTCC
CTTTTTCAGATTGGGATTTTTTTCGTGTTATTTTTGGGTATTATAAAGTA
TCAACCCAATACTATGAAAATAGTTGCGTTTTGGTCCCTCAAAAAAGGAT
TATTTATGTTTGGGGTAAGTCTAAAATGATTTCCAAAATATAAATTTTAT
ATTTTAATAAAAATAAAATACAAATTTTGTTTTGAACTTAATATAGATAT
ATCTCATCGTATATTATCTAATTGGTAATATTACTTTATCCTAC
Genomic location of TG651  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D77 marker 77
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)