SGN Marker C2_At3g12490

SGN-M7716
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302165 (SGN)
119747 (CGN)
---
Capsicum annuumSingleSGN-U197021---
Lycopersicon CombinedMultipleSGN-U213642---
Solanum tuberosumSingleSGN-U247504---
ArabidopsisSingleAt3g12490 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38456)
Chromosome
3
Position
72.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39696
Forward primer (5'-3')
ACTGCACCACCTCACTCTTGAGGTC
Accessions and product sizes
Solanum pennellii TA56
700+750
Solanum lycopersicum TA209
700+750
Approximate temperature
55°C
Reverse primer (5'-3')
TGGATGTATAGAGTTGGATCTCTGCTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
600525
Solanum pennellii TA56
300+425+475
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26143)
Chromosome
3
Position
3.96 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32387
Forward primer (5'-3')
ACTGCACCACCTCACTCTTGAGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGATGTATAGAGTTGGATCTCTGCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 32388
Forward primer (5'-3')
ACTGCACCACCTCACTCTTGAGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGATGTATAGAGTTGGATCTCTGCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 32389
Forward primer (5'-3')
ACTGCACCACCTCACTCTTGAGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGATGTATAGAGTTGGATCTCTGCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 32390
Forward primer (5'-3')
ACTGCACCACCTCACTCTTGAGGTC
Digested band sizes (using DpnII)
Solanum pennellii LA716: 175+300
Solanum lycopersicum LA925: 150+475
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGATGTATAGAGTTGGATCTCTGCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g12490  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7716 marker 7716
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)