SGN Marker C2_At3g12630

SGN-M7718
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple300235 (SGN)
120898 (CGN)
---
Capsicum annuumSingleSGN-U196562---
Solanum tuberosumSingleSGN-U245393---
ArabidopsisSingleAt3g12630 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42214)
Chromosome
1
Position
71.80 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43780
Forward primer (5'-3')
CAAACAATATGTGTCAAAAGTGCTTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATCATGACGATCGGAGTATCGATGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38457)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39697
Forward primer (5'-3')
AGAGAACGGAAAAAGAAGAGACGG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTGCTGCTTTCACGACCGGATTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26145)
Chromosome
3
Position
4.01 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32391
Forward primer (5'-3')
AGAGAACGGAAAAAGAAGAGACGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCTGCTTTCACGACCGGATTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Approximate temperature
53°C
  
PCR data   Exp. ID 32392
Forward primer (5'-3')
AGAGAACGGAAAAAGAAGAGACGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCTGCTTTCACGACCGGATTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 550
Approximate temperature
53°C
  
PCR data   Exp. ID 32393
Forward primer (5'-3')
AGAGAACGGAAAAAGAAGAGACGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCTGCTTTCACGACCGGATTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 550
Approximate temperature
53°C
  
PCR data   Exp. ID 32394
Forward primer (5'-3')
AGAGAACGGAAAAAGAAGAGACGG
Digested band sizes (using HindIII)
Solanum lycopersicum LA925: 200+350
Solanum pennellii LA716: 550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCTGCTTTCACGACCGGATTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 550
Approximate temperature
53°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g12630  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7718 marker 7718
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)