SGN Marker C2_At3g12685

SGN-M7720
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U201130---
Lycopersicon CombinedSingleSGN-U219762---
Solanum tuberosumSingleSGN-U249396---
ArabidopsisSingleAt3g12685 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49241)
Chromosome
1
Position
0.60 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47176)
Chromosome
1
Position
4.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46659)
Chromosome
11
Position
92.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46480)
Chromosome
11
Position
91.00 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41410)
Chromosome
1
Position
111.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43386
Forward primer (5'-3')
ATTTTTGGTTTAGCAGTGGTTTACGC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CTTTGTCTCATGGACACTTGGAGTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38458)
Chromosome
1
Position
7.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39698
Forward primer (5'-3')
ATTTTTGGTTTAGCAGTGGTTTACGC
Accessions and product sizes
Solanum pennellii TA56
300
Solanum lycopersicum TA209
300
Approximate temperature
55°C
Reverse primer (5'-3')
AATGCCTACTTCCCTTCGGACTCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
300
Solanum lycopersicum TA209
225
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26147)
Chromosome
3
Position
4.03 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g12685  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7720 marker 7720
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)