SGN Marker C2_At3g13050

SGN-M7724
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple300474 (SGN)
119693 (CGN)
---
Lycopersicon CombinedSingleSGN-U224300---
Solanum tuberosumSingleSGN-U258065---
ArabidopsisSingleAt3g13050 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38459)
Chromosome
7
Position
27.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39699
Forward primer (5'-3')
TGCCTATTATGGCATTATATTGCTG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AGAAATGAAAGTACGAGCACCAAATAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26151)
Chromosome
3
Position
4.18 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32395
Forward primer (5'-3')
TGCCTATTATGGCATTATATTGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAATGAAAGTACGAGCACCAAATAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 32396
Forward primer (5'-3')
TGCCTATTATGGCATTATATTGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAATGAAAGTACGAGCACCAAATAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 375
Approximate temperature
55°C
  
PCR data   Exp. ID 32397
Forward primer (5'-3')
TGCCTATTATGGCATTATATTGCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAATGAAAGTACGAGCACCAAATAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 375
Approximate temperature
55°C
  
PCR data   Exp. ID 32398
Forward primer (5'-3')
TGCCTATTATGGCATTATATTGCTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 375
Solanum pennellii LA716: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAATGAAAGTACGAGCACCAAATAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 375
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g13050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7724 marker 7724
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)