SGN Marker C2_At3g13700

SGN-M7731
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309878 (SGN)
131269 (CGN)
---
Lycopersicon CombinedSingleSGN-U221592---
Solanum tuberosumSingleSGN-U263788---
ArabidopsisSingleAt3g13700 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46662)
Chromosome
3
Position
89.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46481)
Chromosome
3
Position
85.10 cM
Confidence
CF(LOD3)
Protocol
dCAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42216)
Chromosome
3
Position
147.30 cM
Confidence
I
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43782
Forward primer (5'-3')
TTCCGAGCCCGAGAATCCTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACGCACCTTGAGGGTGTTAAATCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41413)
Chromosome
3
Position
137.20 cM
Confidence
I(LOD2)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43389
Forward primer (5'-3')
TTCCGAGCCCGAGAATCCTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACGCACCTTGAGGGTGTTAAATCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38462)
Chromosome
3
Position
159.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39702
Forward primer (5'-3')
TTCCGAGCCCGAGAATCCTG
Accessions and product sizes
Solanum lycopersicum TA209
450
Solanum pennellii TA56
450
Approximate temperature
55°C
Reverse primer (5'-3')
ACGCACCTTGAGGGTGTTAAATCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
200
Solanum lycopersicum TA209
250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26159)
Chromosome
3
Position
4.49 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At3g13700  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7731 marker 7731
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)