Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker C2_At3g14200

SGN-M7736
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U197280---
Lycopersicon CombinedSingleSGN-U215695---
Solanum tuberosumMultipleSGN-U244803---
ArabidopsisSingleAt3g14200 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46664)
Chromosome
3
Position
106.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46483)
Chromosome
3
Position
80.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38465)
Chromosome
3
Position
166.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39705
Forward primer (5'-3')
TTATGCAGTTTTGGGGTTGAAGAAGG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TCACCAGAGTCATAAACTCCTACATCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26164)
Chromosome
3
Position
4.71 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g14200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7736 marker 7736
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)