SGN Marker C2_At3g14770

SGN-M7739
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301157 (SGN)
124967 (CGN)
---
Lycopersicon CombinedSingleSGN-U231080---
Solanum tuberosumSingleSGN-U255361---
ArabidopsisSingleAt3g14770 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38466)
Chromosome
7
Position
56.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39706
Forward primer (5'-3')
TCAACTGAACAGTTCTCAGGGTTGCC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AACATTGATATCAAGGAAGCACAACTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26167)
Chromosome
3
Position
4.96 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32403
Forward primer (5'-3')
TCAACTGAACAGTTCTCAGGGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACATTGATATCAAGGAAGCACAACTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 425
Approximate temperature
55°C
  
PCR data   Exp. ID 32404
Forward primer (5'-3')
TCAACTGAACAGTTCTCAGGGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACATTGATATCAAGGAAGCACAACTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 425
Approximate temperature
55°C
  
PCR data   Exp. ID 32405
Forward primer (5'-3')
TCAACTGAACAGTTCTCAGGGTTGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACATTGATATCAAGGAAGCACAACTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 425
Approximate temperature
55°C
  
PCR data   Exp. ID 32406
Forward primer (5'-3')
TCAACTGAACAGTTCTCAGGGTTGCC
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 325
Solanum pennellii LA716: 425
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACATTGATATCAAGGAAGCACAACTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 425
Solanum pennellii LA716: 425
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g14770  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7739 marker 7739
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)