SGN Marker C2_At3g17000

SGN-M7766
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299946 (SGN)
122310 (CGN)
---
Lycopersicon CombinedMultipleSGN-U215785---
Solanum tuberosumSingleSGN-U248263---
ArabidopsisSingleAt3g17000 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46670)
Chromosome
12
Position
69.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38476)
Chromosome
12
Position
115.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39715
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
Accessions and product sizes
Solanum pennellii TA56
700
Solanum lycopersicum TA209
700
Approximate temperature
55°C
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
500
Solanum pennellii TA56
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26196)
Chromosome
3
Position
5.80 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11075
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11076
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 11077
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13232
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13233
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 13234
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13235
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13236
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13237
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 13238
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13239
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 13240
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 13241
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13242
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 13243
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 33030
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33031
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33032
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 11078
Forward primer (5'-3')
TTCCGATGATTTCATGAGCCTTCC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGGACCCCTGATTGCAAATTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g17000  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7766 marker 7766
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)