SGN Marker C2_At3g17020

SGN-M7767
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302438 (SGN)
123923 (CGN)
---
Capsicum annuumSingleSGN-U197872---
Lycopersicon CombinedMultipleSGN-U213773---
Solanum tuberosumSingleSGN-U245107---
ArabidopsisSingleAt3g17020 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26197)
Chromosome
3
Position
5.80 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41396
Forward primer (5'-3')
AAGAGGTATGGGGTTAACCCTGAC
Accessions and product sizes
Solanum lycopersicum TA209
550
Solanum pennellii TA56
550
Approximate temperature
55°C
Reverse primer (5'-3')
TTACACTGCCCATAATAACCCTCTTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
400
Solanum lycopersicum TA209
550
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g17020  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7767 marker 7767
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)