SGN Marker C2_At3g17210

SGN-M7771
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple306079 (SGN)
127026 (CGN)
---
Capsicum annuumSingleSGN-U197777---
Lycopersicon CombinedMultipleSGN-U214933---
Solanum tuberosumSingleSGN-U263191---
ArabidopsisSingleAt3g17210 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38478)
Chromosome
5
Position
99.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39717
Forward primer (5'-3')
AGCACATTTTGCTAGCAAAGTTCAAAG
Accessions and product sizes
Solanum lycopersicum TA209
600
Solanum pennellii TA56
600
Approximate temperature
55°C
Reverse primer (5'-3')
TGATGAAGATTTTCTATGCTCACATCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26201)
Chromosome
3
Position
5.88 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11083
Forward primer (5'-3')
AGCACATTTTGCTAGCAAAGTTCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGAAGATTTTCTATGCTCACATCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11084
Forward primer (5'-3')
AGCACATTTTGCTAGCAAAGTTCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGAAGATTTTCTATGCTCACATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11085
Forward primer (5'-3')
AGCACATTTTGCTAGCAAAGTTCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGAAGATTTTCTATGCTCACATCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11086
Forward primer (5'-3')
AGCACATTTTGCTAGCAAAGTTCAAAG
Digested band sizes (using RsaI)
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 1300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGAAGATTTTCTATGCTCACATCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At3g17210  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7771 marker 7771
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)