SGN Marker C2_At3g18860

SGN-M7793
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303415 (SGN)
123979 (CGN)
---
Lycopersicon CombinedSingleSGN-U224524---
Solanum tuberosumMultipleSGN-U258604---
ArabidopsisSingleAt3g18860 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46674)
Chromosome
1
Position
51.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42218)
Chromosome
1
Position
142.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43784
Forward primer (5'-3')
TTCTTACCGTGAACAAATTGTGGAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACTCTGAAACTTTCTTGAGGATACCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41420)
Chromosome
1
Position
54.70 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43396
Forward primer (5'-3')
TTCTTACCGTGAACAAATTGTGGAG
Accessions and product sizes
Approximate temperature
53°C
Reverse primer (5'-3')
ACTCTGAAACTTTCTTGAGGATACCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38485)
Chromosome
1
Position
157.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39720
Forward primer (5'-3')
TTCTTACCGTGAACAAATTGTGGAG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ACTCTGAAACTTTCTTGAGGATACCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26223)
Chromosome
3
Position
6.51 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g18860  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7793 marker 7793
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)