Sol Genomics Network

SGN Marker C2_At3g19630

SGN-M7799
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Coffee	Single	307066 (SGN) 130002 (CGN)	-	-	-
Capsicum annuum	Single	SGN-U200295	-	-	-
Lycopersicon Combined	Multiple	SGN-U215043	-	-	-
Solanum tuberosum	Single	SGN-U256187	-	-	-
Arabidopsis	Single	At3g19630 on TAIR	-	-	-

Mapped locations

Map: Pepper-COSII
Map version 58 (location: 41421)
Chromosome 1
Position 229.50 cM
Confidence F(LOD3)
Protocol CAPS

Pepper-COSII

PCR data Exp. ID 43397

Forward primer (5'-3')

ACGGGGTTACCACCAAGCTCC

Accessions and product sizes

Approximate temperature

55°C

Reverse primer (5'-3')

TTTCCATTTAATTTCCCCAAGC

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

Unknown

Enzymes

Map: Tomato-EXPEN 2000
Map version 52 (location: 38489)
Chromosome 1
Position 146.30 cM
Confidence I(LOD2)
Protocol CAPS

Tomato-EXPEN 2000

PCR data Exp. ID 39723

Forward primer (5'-3')

ACGGGGTTACCACCAAGCTCC

Accessions and product sizes

Solanum pennellii TA56

100

Solanum lycopersicum TA209

100

Approximate temperature

55°C

Reverse primer (5'-3')

TTTCCATTTAATTTCCCCAAGC

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

1.5mM

Enzymes

Map: Arabidopsis COSII
Map version 44 (location: 26229)
Chromosome 3
Position 6.82 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 11098
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Solanum pennellii LA716: 350	Approximate temperature 55°C

PCR data Exp. ID 11099
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 350	Approximate temperature 55°C

PCR data Exp. ID 11100
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 350	Approximate temperature 55°C

PCR data Exp. ID 13244
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Solanum tuberosum TA3427: 350	Approximate temperature 55°C

PCR data Exp. ID 13245
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Solanum melongena TA2986: 330	Approximate temperature 55°C

PCR data Exp. ID 13246
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Capsicum annuum TA3428: 850	Approximate temperature 55°C

PCR data Exp. ID 13247
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Nicotiana sylvestris TA3346: 600	Approximate temperature 55°C

PCR data Exp. ID 13248
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Nicotiana sylvestris TA3347: 600+350	Approximate temperature 55°C

PCR data Exp. ID 13249
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Nicotiana tomentosiformis TA3349: 600+350	Approximate temperature 55°C

PCR data Exp. ID 13250
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Nicotiana otophora TA3350: 600+350	Approximate temperature 55°C

PCR data Exp. ID 13251
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Physalis TA1367: 300	Approximate temperature 55°C

PCR data Exp. ID 13252
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Petunia axillaris TA3309: 400+650	Approximate temperature 55°C

PCR data Exp. ID 13253
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Petunia axillaris subsp. parodii TA3310: 600	Approximate temperature 55°C

PCR data Exp. ID 13254
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Petunia x hybrida TA3311: 600	Approximate temperature 55°C

PCR data Exp. ID 13255
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Petunia integrifolia TA3312: 650	Approximate temperature 55°C

PCR data Exp. ID 13256
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Coffea canephora BP409: 320	Approximate temperature 55°C

PCR data Exp. ID 33033
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Nicotiana sylvestris TA3346: 600	Approximate temperature 55°C

PCR data Exp. ID 33034
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Nicotiana sylvestris TA3347: 600+350	Approximate temperature 55°C

PCR data Exp. ID 33035
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Nicotiana tomentosiformis TA3349: 600+350	Approximate temperature 55°C

PCR data Exp. ID 33036
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes
Accessions and product sizes Nicotiana otophora TA3350: 600+350	Approximate temperature 55°C

PCR data Exp. ID 11101
Forward primer (5'-3') ACGGGGTTACCACCAAGCTCC	Digested band sizes (using DraI) Solanum lycopersicum LA925: 190 Solanum pennellii LA716: 300	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TTTCCATTTAATTTCCCCAAGC	Enzymes All possible enzymes for pennellii and and lycopersicum: AluI, MspI, DraI
Accessions and product sizes Solanum pennellii LA716: 350 Solanum lycopersicum LA925: 350	Approximate temperature 55°C

Unigene blast matches for primers

SGN-U215043
SGN-U233111

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At3g19630

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7799 marker 7799

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer