SGN Marker C2_At3g19640

SGN-M7800
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301697 (SGN)
122380 (CGN)
---
Lycopersicon CombinedSingleSGN-U219655---
ArabidopsisSingleAt3g19640 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26230)
Chromosome
3
Position
6.82 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41412
Forward primer (5'-3')
ACTGTGTTGGGTCGTGAACGGGC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTATCCAAGCAACTGCAAGCAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g19640  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7800 marker 7800
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)