SGN Marker C2_At3g20240

SGN-M7812
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U204718---
Lycopersicon CombinedSingleSGN-U238437---
ArabidopsisSingleAt3g20240 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132187)
Chromosome
3
Position
136.47 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Eggplant-COSII   
Map version
63 (location: 42219)
Chromosome
3
Position
155.50 cM
Confidence
I
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43785
Forward primer (5'-3')
AGATTGGCAATGCTAGCCTGAGATT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGCTCCAACTAGGAGCATCTCTGCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41423)
Chromosome
3
Position
145.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43399
Forward primer (5'-3')
AGAATGGTAGTTGGTGTTGGGTCCAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGCTCCAACTAGGAGCATCTCTGCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38496)
Chromosome
3
Position
171.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39727
Forward primer (5'-3')
AGAATGGTAGTTGGTGTTGGGTCCAG
Accessions and product sizes
Solanum lycopersicum TA209
2300
Approximate temperature
55°C
Reverse primer (5'-3')
AGCTCCAACTAGGAGCATCTCTGCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26242)
Chromosome
3
Position
7.06 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11109
Forward primer (5'-3')
AGAATGGTAGTTGGTGTTGGGTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTCCAACTAGGAGCATCTCTGCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 11110
Forward primer (5'-3')
AGAATGGTAGTTGGTGTTGGGTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTCCAACTAGGAGCATCTCTGCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 11111
Forward primer (5'-3')
AGAATGGTAGTTGGTGTTGGGTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTCCAACTAGGAGCATCTCTGCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 32408
Forward primer (5'-3')
AGAATGGTAGTTGGTGTTGGGTCCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTCCAACTAGGAGCATCTCTGCAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AflII
All possible enzymes for lycopersicum and pimpinellifolium: ApeKI/TseI,BstMWI/HpyF10VI/MwoI,Fnu4HI/Fsp4HI/ItaI/SatI/BthCI
  
Accessions and product sizes
Solanum pennellii LA716: 700
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g20240F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At3g20240  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7812 marker 7812
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)