Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker SSR111

SGN-M784

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 42.857 High: 42.857
Repeat motif: TC   Repeat number: 6
Repeat motif: TCTG   Repeat number: 6
Repeat motif:    Repeat number:
Forward primer: TTCTTCCCTTCCATCAGTTCT
Reverse primer: TTTGCTGCTATACTGCTGACA
Predicted size: 188
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43778)
Chromosome
3
Position
65.40 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44774
Forward primer (5'-3')
TTCTTCCCTTCCATCAGTTCT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTTGCTGCTATACTGCTGACA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43238)
Chromosome
3
Position
52.50 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44588
Forward primer (5'-3')
TTCTTCCCTTCCATCAGTTCT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTTGCTGCTATACTGCTGACA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40776)
Chromosome
3
Position
70.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39164)
Chromosome
3
Position
73.90 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 46
Forward primer (5'-3')
TTCTTCCCTTCCATCAGTTCT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTGCTGCTATACTGCTGACA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 188+188
Solanum lycopersicum LA925: 188+200
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR111 was used as an overgo probe on plate 9 [well F6]

Plausible BAC Matches:   P188K08,   P236C11

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGATGCTGATTCGACCTCGCCATT
B sequence
AAGGCGTGAATTCTGCAATGGCGA
AB sequence
TGATGCTGATTCGACCTCGCCATTGCAGAA
Marker sequence
CAACCCCAAATGATTTTCTCTGTAAATTCTTCCCTTCCATCAGTTCTACT
ACTGATATACTACTCTAGCTACTACTACTAGTATTACTACTACTGGAATT
TTTACTCTTTTCTTGATATAGAGACTCAAAATTTCTTTGTTTCTTCTGTC
TGTCTGTCTGTCTGTCTGTCTCTCTCTCTCTTTTCTCTCTCTATGTCAGC
AGTATAGCAGCAAAACATCCTCATTTCTTGATAAAGCATCATTCTTGTTT
ACTTAAGTTGTGAAATTGGAACTTGTTGCTTGTTTGCTGCAAGAATCTGC
TTCCCACCGACACCATGGCTACCAAATCAAAATCCACTCTGGGGGATACT
CCTAATAAGTCAACACCAGCAACTCCTCGAGACCGGGTGAGCAAATTGAG
CAGGGGACTGTCAAAGTCTGATGCTGATTCGACCTCGCCATTGCAGAATT
CACGCCTTCCAGTTGAGAAATCTCCAAGATCTGTTACTTCCAAGCCTTCT
GTGGAACGGCGGTCTCCTAAGATCAGTACTCCACCTGATAAAAAGCCAAT
GCGGATCCTGAACCCATCAGAGCTGCAAGCTGAATTGAATGTTGTTCATG
Genomic location of SSR111  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D784 marker 784
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)