SGN Marker C2_At3g23400

SGN-M7853
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310636 (SGN)
127380 (CGN)
---
Lycopersicon CombinedSingleSGN-U242313---
Solanum tuberosumSingleSGN-U247199---
ArabidopsisSingleAt3g23400 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41424)
Chromosome
3
Position
19.40 cM
Confidence
F(LOD3)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43400
Forward primer (5'-3')
TGGGCTAAACAGAGGTCTTGCTGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TATAAGTTCAAATTTGTGGGCTAAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38506)
Chromosome
9
Position
84.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39732
Forward primer (5'-3')
TGGGCTAAACAGAGGTCTTGCTGC
Accessions and product sizes
Solanum lycopersicum TA209
300+2500
Solanum pennellii TA56
300+2500
Approximate temperature
55°C
Reverse primer (5'-3')
TATAAGTTCAAATTTGTGGGCTAAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26284)
Chromosome
3
Position
8.38 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11124
Forward primer (5'-3')
TGGGCTAAACAGAGGTCTTGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATAAGTTCAAATTTGTGGGCTAAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 11125
Forward primer (5'-3')
TGGGCTAAACAGAGGTCTTGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATAAGTTCAAATTTGTGGGCTAAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 11126
Forward primer (5'-3')
TGGGCTAAACAGAGGTCTTGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATAAGTTCAAATTTGTGGGCTAAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32410
Forward primer (5'-3')
TGGGCTAAACAGAGGTCTTGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATAAGTTCAAATTTGTGGGCTAAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Approximate temperature
53°C
  
PCR data   Exp. ID 32411
Forward primer (5'-3')
TGGGCTAAACAGAGGTCTTGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATAAGTTCAAATTTGTGGGCTAAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Approximate temperature
53°C
  
PCR data   Exp. ID 32412
Forward primer (5'-3')
TGGGCTAAACAGAGGTCTTGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TATAAGTTCAAATTTGTGGGCTAAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g23400F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g23400F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At3g23400  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7853 marker 7853
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)