Sol Genomics Network

SGN Marker C2_At3g23590

SGN-M7856
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Coffee	Single	312241 (SGN) 130590 (CGN)	-	-	-
Lycopersicon Combined	Single	SGN-U231863	-	-	-
Arabidopsis	Single	At3g23590 on TAIR	-	-	-

Mapped locations

Map: Tomato - Kazusa and SolCAP markers mapped to genome
Map version 105 (location: 49246)
Chromosome 1
Position 71.92 MB
Confidence uncalculated
Protocol CAPS

Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map
Map version 103 (location: 47181)
Chromosome 1
Position 52.40 cM
Confidence uncalculated
Protocol unknown

Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis
Map version 91 (location: 46679)
Chromosome 9
Position 45.00 cM
Confidence F(LOD3)
Protocol CAPS

Tobacco N. tomentosiformis

Map: Tobacco N. acuminata
Map version 89 (location: 46490)
Chromosome 9
Position 21.80 cM
Confidence F(LOD3)
Protocol dCAPS

Tobacco N. acuminata

Map: Eggplant-COSII
Map version 63 (location: 42220)
Chromosome 1
Position 61.20 cM
Confidence F(LOD3)
Protocol CAPS

Eggplant-COSII

PCR data Exp. ID 43786

Forward primer (5'-3')

TCGAAGCTGTCCCCTTTGTGGTTG

Accessions and product sizes

Approximate temperature

63°C

Reverse primer (5'-3')

AGGCTTGGAACATCTACACCAGTGGC

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

Unknown

Enzymes

Map: Pepper-COSII
Map version 58 (location: 41425)
Chromosome 1
Position 138.70 cM
Confidence F(LOD3)
Protocol CAPS

Pepper-COSII

PCR data Exp. ID 43401

Forward primer (5'-3')

TCGAAGCTGTCCCCTTTGTGGTTG

Accessions and product sizes

Approximate temperature

55°C

Reverse primer (5'-3')

AGGCTTGGAACATCTACACCAGTGGC

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

Unknown

Enzymes

Map: Tomato-EXPEN 2000
Map version 52 (location: 38508)
Chromosome 1
Position 46.50 cM
Confidence I
Protocol CAPS

Tomato-EXPEN 2000

PCR data Exp. ID 39733

Forward primer (5'-3')

TCGAAGCTGTCCCCTTTGTGGTTG

Accessions and product sizes

Approximate temperature

55°C

Reverse primer (5'-3')

AGGCTTGGAACATCTACACCAGTGGC

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

1.5mM

Enzymes

Map: Arabidopsis COSII
Map version 44 (location: 26287)
Chromosome 3
Position 8.47 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 11127
Forward primer (5'-3') TCGAAGCTGTCCCCTTTGTGGTTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AGGCTTGGAACATCTACACCAGTGGC	Enzymes
Accessions and product sizes Solanum pennellii LA716: 530	Approximate temperature 55°C

PCR data Exp. ID 11128
Forward primer (5'-3') TCGAAGCTGTCCCCTTTGTGGTTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AGGCTTGGAACATCTACACCAGTGGC	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 500	Approximate temperature 55°C

PCR data Exp. ID 11129
Forward primer (5'-3') TCGAAGCTGTCCCCTTTGTGGTTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AGGCTTGGAACATCTACACCAGTGGC	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 500	Approximate temperature 55°C

PCR data Exp. ID 11130
Forward primer (5'-3') TCGAAGCTGTCCCCTTTGTGGTTG	Digested band sizes (using amplicon difference) Solanum pennellii LA716: 530 Solanum lycopersicum LA925: 500	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AGGCTTGGAACATCTACACCAGTGGC	Enzymes All possible enzymes for pennellii and and lycopersicum: AseI
Accessions and product sizes Solanum pennellii LA716: 530 Solanum lycopersicum LA925: 500	Approximate temperature 55°C

Unigene blast matches for primers

SGN-U231863

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At3g23590

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7856 marker 7856

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: