SGN Marker C2_At3g25910

SGN-M7877
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303161 (SGN)
123845 (CGN)
---
Lycopersicon CombinedSingleSGN-U216294---
Solanum tuberosumMultipleSGN-U245449---
ArabidopsisSingleAt3g25910 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41430)
Chromosome
9
Position
72.30 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43406
Forward primer (5'-3')
CCTAAGGAGAGAAGAGATAGGTCTGT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATGTCTCGCTAGAGCAGCTTCTTAAAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38516)
Chromosome
12
Position
24.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39739
Forward primer (5'-3')
AAGGTCATCATTGTCCAAAAACCC
Accessions and product sizes
Solanum lycopersicum TA209
1050
Solanum pennellii TA56
1050
Approximate temperature
55°C
Reverse primer (5'-3')
TCGCATGTCTCGCTAGAGCAGCTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
500
Solanum lycopersicum TA209
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26309)
Chromosome
3
Position
9.49 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g25910  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7877 marker 7877
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)