SGN Marker SSR115

SGN-M788

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 40.909
Repeat motif: AT   Repeat number: 16
Repeat motif:    Repeat number:
Forward primer: CACCCTTTATTCAGATTCCTCT
Reverse primer: ATTGAGGGTATGCAACAGCC
Predicted size: 211
Derivations 
This marker was derived from EST read SGN-E143578
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49359)
Chromosome
5
Position
2.73 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47294)
Chromosome
5
Position
36.67 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43779)
Chromosome
5
Position
11.80 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44775
Forward primer (5'-3')
CACCCTTTATTCAGATTCCTCT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTGAGGGTATGCAACAGCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43239)
Chromosome
5
Position
14.30 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44589
Forward primer (5'-3')
CACCCTTTATTCAGATTCCTCT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTGAGGGTATGCAACAGCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40777)
Chromosome
5
Position
12.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39166)
Chromosome
5
Position
35.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14114
Forward primer (5'-3')
CACCCTTTATTCAGATTCCTCT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ATTGAGGGTATGCAACAGCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 211+213
Solanum pimpinellifolium LA1589: 197+211
Approximate temperature
50°C
  
PCR data   Exp. ID 70
Forward primer (5'-3')
CACCCTTTATTCAGATTCCTCT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTGAGGGTATGCAACAGCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 211+211
Solanum lycopersicum LA925: 211+223
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR115 was used as an overgo probe on plate 11 [well C10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TTGTGGAGTCTGGTATGGTTGTTG
B sequence
GACCCTGTACCTAAACCAACAACC
AB sequence
TTGTGGAGTCTGGTATGGTTGTTGGTTTAG
Marker sequence
GGTTTATTGCTTCAAGGATTCTGTCACACCTCTTTCTCCCCCGACAAATC
CTTCACTTTCCTTCTTTTCCTCTCAATTTCCCTATAAATTCTCCATAAAC
CCTAATAAACCAAACGCCAAATAACATTATCTTCTCCCATTCCACAAGTT
CCAATCTTGATAATCATTTTTTTCTTTTCTTTTTACAGAATAAAGAAACA
CCCTTTATTCAGATTCCTCTGTTTCTTGATTTTTCATCTATATATATATA
TATATATATATATATATATATAGTCTAATGGTTTCAATCTTCAATTTACT
CAAACCCCTTTAACATTTTTATGCTAAAGATTCAATCTTTATCTTGAAAT
TTTTGATATTTCCTTAATTGTTGTGTTGTTTTTAGCAATGGCTGTTGCAT
ACCCTCAATTTTTTGGGACAAAGAAAGTTGACACTTCATTGATGGTGTCA
TCATCTTCCTCTGTTTCCCCTGTTATTNTATCTCAAGATGAGTTGAAAAA
GATAGCTGCTTATAAAGCTGTGGAGTTTGTGGAGTCTGGTATGGTTGTTG
GTTTAGGTACAGGGTCAACAGCAAAGCATGCTGTTGATAAAATAGCTGAG
CTTTTACATAGTGGTAAGTTAAAGAACATTGTAGGGATTCCCACTTCAAA
GATTACTCATGAACAAGCTG
Genomic location of SSR115  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D788 marker 788
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)