SGN Marker C2_At3g27200

SGN-M7897
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312204 (SGN)
131495 (CGN)
---
Lycopersicon CombinedSingleSGN-U236031---
ArabidopsisSingleAt3g27200 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46683)
Chromosome
2
Position
7.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46492)
Chromosome
2
Position
23.80 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41432)
Chromosome
2
Position
138.50 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43408
Forward primer (5'-3')
ACACGTTGTTGGTGGAAGCCAAGG
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TCCCTGGTCACAATGACCTGCTGTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38520)
Chromosome
2
Position
139.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39742
Forward primer (5'-3')
ACACGTTGTTGGTGGAAGCCAAGG
Accessions and product sizes
Solanum lycopersicum TA209
475
Solanum pennellii TA56
475
Approximate temperature
55°C
Reverse primer (5'-3')
TCCCTGGTCACAATGACCTGCTGTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
425
Solanum lycopersicum TA209
225
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26330)
Chromosome
3
Position
10.05 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g27200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7897 marker 7897
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)