SGN Marker SSR117

SGN-M790

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 45
Repeat motif: TC   Repeat number: 11
Repeat motif:    Repeat number:
Forward primer: AATTCACCTTTCTTCCGTCG
Reverse primer: GCCCTCGAATCTGGTAGCTT
Predicted size: 241
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39167)
Chromosome
1
Position
138.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 16
Forward primer (5'-3')
AATTCACCTTTCTTCCGTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GCCCTCGAATCTGGTAGCTT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 241+243
Solanum pennellii LA716: 241+249
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR117 was used as an overgo probe on plate 10 [well B1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTTTCTCTTGTGGGTGGCAATCAC
B sequence
AAAACCTAGCGGCGGTGTGATTGC
AB sequence
GTTTCTCTTGTGGGTGGCAATCACACCGCC
Marker sequence
TGTTATTTTTTCCCCTTAATTGTGGATGTTGGTTGAGTTATAGATCATCT
AATTTCATTTCTGGGTGTACCTAGAAACTCAATTTTTCATGGGGTTTTCT
TGACCTTTTTATTGAATGCTTCCAACAGAAAAAATCATGGAGGTTGCTAG
AATTAGACAATTGCTGCTCCTTTGGAGTAGAATCAAATCTACCCGTGTTT
CTCTTGTGGGTGGCAATCACACCGCCGCTAGGTTTTGTACTCGCTAAATT
CACCTTTCTTCCGTCGCTGGATTTTCCCCTTTCTCTCTCTCTCTCTCTCT
CTCTTCTTGTAGCACAAGGTACGATCAGTTTTTACAGACTCTTCCGATAG
GTTTGTTGTAAAAGCATGGATTTTGGTTTTGTGTATTGCCCCAAAAGGGG
GGAAATCAAGGGGAATCATTTTCCCGAGTTGAAAATTGGGTTGCATCAAG
ACGCCGTTTTGATTATTAAGCTACCAGATTCGAGGGCTTTAAGGATTATG
TCACGGTCTTTGTTCTTTGCAATGGTTCTTTTCATATTGCCGTCAATTGG
GTCCATTTTAAGAGGCTCATTCCACGTAATTGATGATTCTTATGTGA
Genomic location of SSR117  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D790 marker 790
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)