SGN Marker C2_At3g44600

SGN-M7923
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308742 (SGN)
131823 (CGN)
---
Capsicum annuumSingleSGN-U200127---
Lycopersicon CombinedMultipleSGN-U218111---
Solanum tuberosumSingleSGN-U268046---
ArabidopsisSingleAt3g44600 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109237)
Chromosome
11
Position
43.99 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49249)
Chromosome
11
Position
49.92 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47185)
Chromosome
11
Position
82.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46687)
Chromosome
11
Position
71.00 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41433)
Chromosome
11
Position
99.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43409
Forward primer (5'-3')
TCCTTTATACCGACTTGAAGCTATTG
Accessions and product sizes
Approximate temperature
53°C
Reverse primer (5'-3')
AGATTCTATGTTTCTTGAAAGCACAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38528)
Chromosome
11
Position
68.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39747
Forward primer (5'-3')
TCCTTTATACCGACTTGAAGCTATTG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AGATTCTATGTTTCTTGAAAGCACAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26356)
Chromosome
3
Position
16.18 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g44600  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7923 marker 7923
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)