SGN Marker C2_At3g44880

SGN-M7924
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307459 (SGN)
128488 (CGN)
---
Capsicum annuumSingleSGN-U201540---
Lycopersicon CombinedSingleSGN-U216273---
Solanum tuberosumMultipleSGN-U245153---
ArabidopsisSingleAt3g44880 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49250)
Chromosome
11
Position
49.29 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47186)
Chromosome
11
Position
79.20 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38529)
Chromosome
11
Position
61.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39748
Forward primer (5'-3')
ACAAGATTCGTCGTCGAAATTCTC
Accessions and product sizes
Solanum pennellii TA56
280
Solanum lycopersicum TA209
280
Approximate temperature
55°C
Reverse primer (5'-3')
ACCACATCCATTAAATGACCATCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
200
Solanum lycopersicum TA209
280
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26357)
Chromosome
3
Position
16.40 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11179
Forward primer (5'-3')
ACAAGATTCGTCGTCGAAATTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCACATCCATTAAATGACCATCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 11180
Forward primer (5'-3')
ACAAGATTCGTCGTCGAAATTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCACATCCATTAAATGACCATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 11181
Forward primer (5'-3')
ACAAGATTCGTCGTCGAAATTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCACATCCATTAAATGACCATCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 11182
Forward primer (5'-3')
ACAAGATTCGTCGTCGAAATTCTC
Digested band sizes (using DraI)
Solanum pennellii LA716: 320
Solanum lycopersicum LA925: 260
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCACATCCATTAAATGACCATCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI,HinfI,TaqI,Tsp509I
All possible enzymes for lycopersicum and pimpinellifolium: MseI/Tru1I/Tru9I
  
Accessions and product sizes
Solanum lycopersicum LA925: 320
Solanum pennellii LA716: 320
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g44880F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At3g44880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7924 marker 7924
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)