SGN Marker C2_At3g48330

SGN-M7948
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U197327---
Lycopersicon CombinedSingleSGN-U218375---
ArabidopsisSingleAt3g48330 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42225)
Chromosome
3
Position
92.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43791
Forward primer (5'-3')
TGCCGGTAACAGAAACAAGGGAATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATTCCGTACCAAGTCAAACTAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38537)
Chromosome
3
Position
89.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41468
Forward primer (5'-3')
TGCCGGTAACAGAAACAAGGGAATG
Accessions and product sizes
Solanum lycopersicum TA209
475
Solanum pennellii TA56
475
Approximate temperature
55°C
Reverse primer (5'-3')
TCAGAGCAAAACATGCTGTGAGATAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
475
Solanum pennellii TA56
250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26382)
Chromosome
3
Position
17.90 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g48330  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7948 marker 7948
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)