SGN Marker C2_At3g49250

SGN-M7958
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303886 (SGN)
121795 (CGN)
---
Lycopersicon CombinedMultipleSGN-U221558---
Solanum tuberosumSingleSGN-U247969---
ArabidopsisSingleAt3g49250 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26392)
Chromosome
3
Position
18.27 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41471
Forward primer (5'-3')
AGTTCTGGTTTTCATGGACTTGGAGC
Accessions and product sizes
Solanum pennellii TA56
425
Solanum lycopersicum TA209
425
Approximate temperature
58°C
Reverse primer (5'-3')
AGGATATACCACTACTCTTTATGATCCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
425
Solanum lycopersicum TA209
400
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g49250  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7958 marker 7958
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)