SGN Marker C2_At3g49260

SGN-M7959
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304782 (SGN)
124710 (CGN)
---
Lycopersicon CombinedSingleSGN-U241838---
ArabidopsisSingleAt3g49260 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38539)
Chromosome
3
Position
75.90 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39757
Forward primer (5'-3')
ACGCTTATTCAGTCATACTACAGGGG
Accessions and product sizes
Solanum pennellii TA56
2100
Solanum lycopersicum TA209
2100
Approximate temperature
55°C
Reverse primer (5'-3')
ATACATCTCATGGTCATTTGTGCTTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
900
Solanum lycopersicum TA209
1400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26393)
Chromosome
3
Position
18.28 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g49260  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7959 marker 7959
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)