SGN Marker C2_At3g50860

SGN-M7969
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U201970---
Solanum tuberosumSingleSGN-U252835---
ArabidopsisSingleAt3g50860 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46496)
Chromosome
1
Position
7.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38540)
Chromosome
1
Position
157.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41474
Forward primer (5'-3')
AGAGAATGTAAGCAACTTCGTCAAGG
Accessions and product sizes
Solanum pennellii TA56
275
Solanum lycopersicum TA209
275
Approximate temperature
55°C
Reverse primer (5'-3')
TACATTGCTGAAACACTTGTCCATTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
275
Solanum pennellii TA56
150
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26403)
Chromosome
3
Position
18.91 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g50860  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7969 marker 7969
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)