SGN Marker C2_At3g51010

SGN-M7971
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310036 (SGN)
128781 (CGN)
---
Capsicum annuumMultipleSGN-U197430---
Lycopersicon CombinedMultipleSGN-U239442---
Solanum tuberosumSingleSGN-U249360---
ArabidopsisSingleAt3g51010 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132188)
Chromosome
11
Position
51.31 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Solanum michoacanum 2011   
Map version
155 (location: 109238)
Chromosome
4
Position
24.44 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46690)
Chromosome
4
Position
27.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42226)
Chromosome
11
Position
88.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43792
Forward primer (5'-3')
TCCAAACAATCCCAATGAAGGAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACGCTCTACTCGCTTAATCATTTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41438)
Chromosome
5
Position
39.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43414
Forward primer (5'-3')
TCCAAACAATCCCAATGAAGGAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACGCTCTACTCGCTTAATCATTTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38541)
Chromosome
4
Position
19.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39758
Forward primer (5'-3')
TCCAAACAATCCCAATGAAGGAAG
Accessions and product sizes
Solanum pennellii TA56
250
Solanum lycopersicum TA209
250
Approximate temperature
55°C
Reverse primer (5'-3')
ACGCTCTACTCGCTTAATCATTTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26405)
Chromosome
3
Position
18.96 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11209
Forward primer (5'-3')
TCCAAACAATCCCAATGAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTCTACTCGCTTAATCATTTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2100
Approximate temperature
55°C
  
PCR data   Exp. ID 11210
Forward primer (5'-3')
TCCAAACAATCCCAATGAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTCTACTCGCTTAATCATTTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2100
Approximate temperature
55°C
  
PCR data   Exp. ID 11211
Forward primer (5'-3')
TCCAAACAATCCCAATGAAGGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTCTACTCGCTTAATCATTTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2100
Approximate temperature
55°C
  
PCR data   Exp. ID 11212
Forward primer (5'-3')
TCCAAACAATCCCAATGAAGGAAG
Digested band sizes (using EcoRV)
Solanum pennellii LA716: 2100
Solanum lycopersicum LA925: 1100+1000
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTCTACTCGCTTAATCATTTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI, RsaI, TaqI, EcoRV, HaeIII, HinfI
All possible enzymes for lycopersicum and pimpinellifolium: HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 2100
Solanum lycopersicum LA925: 2100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At3g51010  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7971 marker 7971
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)