SGN Marker C2_At3g51050

SGN-M7973
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304474 (SGN)
123803 (CGN)
---
Capsicum annuumSingleSGN-U200396---
Lycopersicon CombinedSingleSGN-U228998---
Solanum tuberosumSingleSGN-U250955---
ArabidopsisSingleAt3g51050 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26407)
Chromosome
3
Position
18.97 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41475
Forward primer (5'-3')
TGGAATTTGGTGTTGCGAGACAAAGAG
Accessions and product sizes
Solanum lycopersicum TA209
900
Solanum pennellii TA56
900
Approximate temperature
58°C
Reverse primer (5'-3')
TTGGCAGGTATTGACGGGTGCCAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
575
Solanum pennellii TA56
900
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g51050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7973 marker 7973
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)