SGN Marker C2_At3g51510

SGN-M7978
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U205213---
Lycopersicon CombinedSingleSGN-U225852---
Solanum tuberosumSingleSGN-U264132---
ArabidopsisSingleAt3g51510 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42227)
Chromosome
2
Position
17.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43793
Forward primer (5'-3')
TTGGAATTGTTGCTGCTACTGAAGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGATTCGTGTACTCGAAAATAGAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41441)
Chromosome
2
Position
36.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43417
Forward primer (5'-3')
TTGGAATTGTTGCTGCTACTGAAGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGATTCGTGTACTCGAAAATAGAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38545)
Chromosome
2
Position
24.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41477
Forward primer (5'-3')
TTGGAATTGTTGCTGCTACTGAAGG
Accessions and product sizes
Solanum pennellii TA56
275
Solanum lycopersicum TA209
225
Approximate temperature
55°C
Reverse primer (5'-3')
TGATTCGTGTACTCGAAAATAGAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26412)
Chromosome
3
Position
19.12 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g51510  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7978 marker 7978
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)