SGN Marker SSR125

SGN-M798

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 40.909 High: 40
Repeat motif: CTAG   Repeat number: 2
Repeat motif: GT   Repeat number: 7
Repeat motif: CTTT   Repeat number: 4
Repeat motif:    Repeat number:
Forward primer: CCTAAAGAAGATAGGAAGAAATGCC
Reverse primer: TCTCTCCTACTGAAACAACCAA
Predicted size: 192
Derivations 
This marker was derived from EST read SGN-E132386
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39170)
Chromosome
2
Position
110.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14089
Forward primer (5'-3')
CCTAAAGAAGATAGGAAGAAATGCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCTCTCCTACTGAAACAACCAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 192+193
Solanum pimpinellifolium LA1589: 191+192
Approximate temperature
50°C
  
Unigene blast matches for primers 
Genomic location of SSR125  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D798 marker 798
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)