SGN Marker C2_At3g52155

SGN-M7992
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U201046---
Lycopersicon CombinedSingleSGN-U223067---
Solanum tuberosumSingleSGN-U256465---
ArabidopsisSingleAt3g52155 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49252)
Chromosome
4
Position
5.52 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47188)
Chromosome
4
Position
38.70 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41443)
Chromosome
5
Position
7.30 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43419
Forward primer (5'-3')
TTCTCATACCCCACTTGTGAGATTCCA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AAGTTGTCCAGATCTACTCAAAGGACG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38552)
Chromosome
4
Position
50.80 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41484
Forward primer (5'-3')
ATGTTGTAGTAGCATCTCTTGTGGAACC
Accessions and product sizes
Solanum pennellii TA56
500
Solanum lycopersicum TA209
500
Approximate temperature
55°C
Reverse primer (5'-3')
AAGTTGTCCAGATCTACTCAAAGGACG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
275
Solanum pennellii TA56
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26426)
Chromosome
3
Position
19.36 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g52155  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7992 marker 7992
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)