SGN Marker TG580

SGN-M80

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG580 image not available
Forward sequence
TAAAAGTTTTACCACATCGGTAGTTTTATTTTCCTTTTTGTACCTTTTATGTGTGGAACATATTGATTCCTCTACTTTATAATTGAACAG
GTCAGGAGGATTACAATAGATTAAGACCTTTGAGCTATCGTGGGGCTGATGTATTTATACTGGCATTTTCTCTCATTAGCAAGGCGAGCT
ATGAAAATGTCTCCAAAAAGGTGAGTTCCTTCTCTTGTATTCTCTGTCTCACTTTTTCTTGGGTTGTACTAGGTCAGGGAAAAGGTGATA
CCTATAGTTGTAAATCTGTATTGGTAGAAAATATAGAGAACTTCTAAAAGTTATTAATTTTTTATTTTGTAAATTATTGGGCATGAGATG
AACTTAAATGGAAATAGATGGTCAATGAGGATTCATGTTGAAGGCTTCAACTTATTAAGGACTGAGGCGTAATTGTCGTAGAACTTAGTC
AGGGAAAT
Reverse sequence
CATTTATTTAAATGAGACATGAAACTTTAAACCAAAACTTAACATTTTTATCTATCTCAAATCTCAATCTGCAATAGGTCACTTCTCAAA
CAGACTTTCTGGCAGCTGGACCACATAACAATTAGAGTTATTGAGAGTGATTATAGCTGAGATCCAAGACTTCTAGTTGTATGAACCAAA
TTTTCTCTCTGCCTAACCATACCAAACTCACATTTTTCTCTGCGACAACATAAGTACTTCTTCAGAGAGTTGGTTCCAGTTTAAAAGGCA
TCCGAAATTCAAGGTTGTGGTGGGCCACAAGTTACTTACTATCTATTGTCTATTGTACCTCCATTATGCATTTTCCTAGTCTGTCTTGAG
CTGGGGGTCTATTGGAAACAGCCTCTCTACACCACCTTTAAGGTAGACATAAGGTTAGCATACACACTACCCTCCCCAAACCCCACTGTG
TGGGACAGCACTGGGTATGTTGTTGCTGAAATTCAAGGTTGCGGTGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1455813.6e-1495 (20.7% of RFLP seq)+
SGN-U1455823.7e-17104 (22.7% of RFLP seq)+
SGN-U1455833.7e-17104 (22.7% of RFLP seq)+
SGN-U1458382.5e-58113 (24.7% of RFLP seq)+
SGN-U1473798.9e-0625 (5.0% of RFLP seq)-
SGN-U1621052.2e-0646 (9.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53570)
Chromosome
1
Position
121.37 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43881)
Chromosome
1
Position
132.90 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43620)
Chromosome
1
Position
115.80 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43343)
Chromosome
1
Position
135.20 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40887)
Chromosome
1
Position
148.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7994)
Chromosome
1
Position
131.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7995)
Chromosome
1
Position
150.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG580 was used as an overgo probe on plate 3 [well B10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAAGGCGAGCTATGAAAATGTCTC
B sequence
GGAACTCACCTTTTTGGAGACATT
AB sequence
CAAGGCGAGCTATGAAAATGTCTCCAAAAA
Marker sequence
TAAAAGTTTTACCACATCGGTAGTTTTATTTTCCTTTTTGTACCTTTTAT
GTGTGGAACATATTGATTCCTCTACTTTATAATTGAACAGGTCAGGAGGA
TTACAATAGATTAAGACCTTTGAGCTATCGTGGGGCTGATGTATTTATAC
TGGCATTTTCTCTCATTAGCAAGGCGAGCTATGAAAATGTCTCCAAAAAG
GTGAGTTCCTTCTCTTGTATTCTCTGTCTCACTTTTTCTTGGGTTGTACT
AGGTCAGGGAAAAGGTGATACCTATAGTTGTAAATCTGTATTGGTAGAAA
ATATAGAGAACTTCTAAAAGTTATTAATTTTTTATTTTGTAAATTATTGG
GCATGAGATGAACTTAAATGGAAATAGATGGTCAATGAGGATTCATGTTG
AAGGCTTCAACTTATTAAGGACTGAGGCGTAATTGTCGTAGAACTTAGTC
AGGGAAAT
Genomic location of TG580  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D80 marker 80
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)