SGN Marker C2_At3g52640

SGN-M8003
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301862 (SGN)
121961 (CGN)
---
Capsicum annuumSingleSGN-U201867---
Lycopersicon CombinedSingleSGN-U238626---
Solanum tuberosumMultipleSGN-U265612---
ArabidopsisSingleAt3g52640 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49253)
Chromosome
11
Position
4.53 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47189)
Chromosome
11
Position
51.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46695)
Chromosome
5
Position
90.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42228)
Chromosome
11
Position
7.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43794
Forward primer (5'-3')
TACCTTGGCAGTAGAAGATTTCTTCTTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AACCCTTTCCAACTGATCCAATTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41444)
Chromosome
12
Position
3.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43420
Forward primer (5'-3')
TACCTTGGCAGTAGAAGATTTCTTCTTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AACCCTTTCCAACTGATCCAATTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38556)
Chromosome
11
Position
36.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41487
Forward primer (5'-3')
TACCTTGGCAGTAGAAGATTTCTTCTTG
Accessions and product sizes
Solanum lycopersicum TA209
1500
Solanum pennellii TA56
1900
Approximate temperature
55°C
Reverse primer (5'-3')
AACCCTTTCCAACTGATCCAATTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26438)
Chromosome
3
Position
19.53 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g52640  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8003 marker 8003
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)