SGN Marker C2_At3g52860

SGN-M8006
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310570 (SGN)
128987 (CGN)
---
Lycopersicon CombinedMultipleSGN-U227869---
Solanum tuberosumSingleSGN-U250329---
ArabidopsisSingleAt3g52860 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49254)
Chromosome
8
Position
0.70 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47190)
Chromosome
8
Position
3.15 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41445)
Chromosome
8
Position
6.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43421
Forward primer (5'-3')
TGTTTGCCAGCACGAGAACTCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATCAGTTTTTGTTTCCAACTCTTCTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38558)
Chromosome
8
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39764
Forward primer (5'-3')
TGTTTGCCAGCACGAGAACTCC
Accessions and product sizes
Solanum lycopersicum TA209
325
Solanum pennellii TA56
325
Approximate temperature
55°C
Reverse primer (5'-3')
ATCAGTTTTTGTTTCCAACTCTTCTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26441)
Chromosome
3
Position
19.60 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text
Forward amplicon sequence for S. quitoense SE plant #1 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1 (2), plain text

Genomic location of C2_At3g52860  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8006 marker 8006
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)