SGN Marker C2_At3g53920

SGN-M8016
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U204388---
Lycopersicon CombinedSingleSGN-U238916---
Solanum tuberosumSingleSGN-U254082---
ArabidopsisSingleAt3g53920 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49256)
Chromosome
8
Position
51.58 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47192)
Chromosome
8
Position
30.70 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46698)
Chromosome
8
Position
45.90 cM
Confidence
CF(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38562)
Chromosome
8
Position
24.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41493
Forward primer (5'-3')
AAATTGCCAAGTTCACGGGTCTATCC
Accessions and product sizes
Solanum lycopersicum TA209
800
Solanum pennellii TA56
800
Approximate temperature
55°C
Reverse primer (5'-3')
ATGACAGTTTCCTCTGGGCTTGTAATTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
800
Solanum lycopersicum TA209
550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26451)
Chromosome
3
Position
19.97 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g53920  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8016 marker 8016
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)