SGN Marker C2_At3g54360

SGN-M8025
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308680 (SGN)
128234 (CGN)
---
Capsicum annuumMultipleSGN-U198557---
Lycopersicon CombinedSingleSGN-U215953---
Solanum tuberosumSingleSGN-U249778---
ArabidopsisSingleAt3g54360 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38564)
Chromosome
10
Position
56.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39765
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
Accessions and product sizes
Solanum lycopersicum TA209
300
Solanum pennellii TA56
300
Approximate temperature
55°C
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
150
Solanum pennellii TA56
220
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26460)
Chromosome
3
Position
20.14 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11236
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 11237
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 11238
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13302
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13303
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13304
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13305
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13306
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13307
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13308
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13309
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13310
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13311
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 32636
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 33052
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 33053
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 33054
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 33055
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 33056
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 11239
Forward primer (5'-3')
AGCTTTCCTGGTTCAACAAGCC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 150
Solanum pennellii LA716: 220
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTGCTCCGAGCTGTGAGCAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g54360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8025 marker 8025
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)